Text-only / Accessible Version Skip Navigation itchy MOLO

Jump to Activity:   

Search the Database:  

A Concord Consortium Project
HomeDatabaseSoftwareHelpResearchAuthoring

Home >> Database >> Activities >> View

In the Database section: Introduction | Search | Browse



Activity Number
245
Editable
Overview and Learning Objectives
Assessment
Classroom Practice
Central Concepts
Textbook References
Benchmarks and Standards
Extensions and Connections
Additional Info
Activity Credits
Requirements

DNA to Protein Synthesis

Interactive, scaffolded model

Activity Screenshot

Go To Activity


Follow the link above to start or download this activity.

This Activity Requires:

  • Java 1.5+ - Java 1.5+ is available for Windows, Linux, and Mac OS X 10.4 and greater. If you are using Mac OS X 10.3, you can download MW Version 1.3 and explore within it instead.

      Test your system to see if it meets the requirements

Important! If you cannot launch anything from this database, please follow the step-by-step instructions on the software page.

Please Note: Many models are linked to directly from within the database. When an activity employs our scripting language, Pedagogica, as do some of the "guided" activities, the initial download may take several minutes. Subsequent activities will not take a long time. See this page for further instructions.

Overview and Learning Objectives

In this activity, students work with a model that shows the entire process from gene transcription and translation, through protein folding of the newly synthesized protein.

Students will be able to:

  • reason how DNA, a linear polymer made of four different types of monomers (adenine, thymine, guanine, and cytosine), can store the genetic code: information about sequence of amino acids in proteins;
  • describe the processes of translation and transcription;
  • compare the structure, location, and function of RNA and DNA;
  • manipulate the DNA code and observe how it changes the sequence of m-RNA and proteins.

return to top

Assessment

TEST

http://www.concord.org/~barbara/workbench_web/pdf/DNA_to_Protein8.07.pdf

RUBRIC

http://www.concord.org/~barbara/workbench_web/pdf/DNA_to_Protein_Rubric.8.07a.pdf

return to top

Classroom Practice

Solution For Designer Challenge 4:

TTTTTTTTTGATTTTGATTTTGATTTTGATTTTTTTTTT

Solution for page 5:

GATGATGATTTTTTTTTTTTTTTTTTTTTTCATCATCAT

return to top

Central Concepts

Key Concept:

The sequence of nucleotides in the DNA serves as a genetic code, dictating the sequence of amino acids in proteins.

Additional Related Concepts

Biology

  • Genetics

Molecular Biology

  • DNA
  • RNA

return to top

Textbook References

  • Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 10 - Genes and Chromosomes
  • Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 7 - Nucleic Acids and Protein Synthesis
  • Biology (Prentice-Hall) New York Edition - Chapter 12: DNA and RNA
  • Biology (Prentice-Hall) New York Edition - Chapter 16: Evolution
  • Biology (Prentice-Hall) New York Edition - Chapter Seven: Cell Structures and Functions
  • Biology: Concepts and Connections (Pearson) 5th Ed. - Chapter 3: The Molecules of Cells
  • Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 10: Molecular Biology of the Gene
  • Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 12: DNA Technology and the Human Genome
  • Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 4: A Tour of the Cell
  • Biology: Exploring Life - Chapter 11: DNA and the Language of Life
  • Biology: The Dynamics of Life - Chapter 11: DNA and Genes
  • BSCS Blue (8th Edition) - Chapter 12: Reproduction
  • BSCS Human - Chapter 12: Gene Action
  • Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 11: Introduction to Nuclear and chromosomal Structure and Function
  • Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 18: Protein Synthesis and Folding in the Cytoplasm
  • Web of Life - Chapter 7: DNA, Genes and Chromosomes

return to top

Benchmarks and Standards

AAAS

  • THE LIVING ENVIRONMENT: CELLS - The genetic information encoded in DNA molecules provides instructions for assembling protein molecules (Full Text of Standard)

NSES

  • Life Science: Heredity Molecular Basis - 1 In all organisms, the instructions for specifying the characteristics of the organism are carried in DNA (Full Text of Standard)

  • Life Science: The Cell - 3 Cells store and use information to guide their functions (Full Text of Standard)

return to top

Extensions and Connections

The flash interactive animation included as a link in this activity stands on its own as a learning tool.

http://molo.concord.org/database/activities/273.html

A logical next activity is Mutations

return to top

Additional Info

Additional Background

  • DNA Interactive (Howard Hughes and Cold Spring Harbor)

http://www.dnai.org/index.htm

Allows students to follow the footsteps of Crick and Watson as they discover DNA. Flash

  • An excellent DNA tutorial done in Chime:

http://www.dnai.org/a/index.html

  • Good DNA links

http://molvis.sdsc.edu/dna/moredna.htm

return to top

Activity Credits

Created by CC Project: Molecular Logic using Molecular Workbench

return to top

Requirements

  • Java 1.5+ - Java 1.5+ is available for Windows, Linux, and Mac OS X 10.4 and greater. If you are using Mac OS X 10.3, you can download MW Version 1.3 and explore within it instead.

return to top



Last Update: 11/25/2008 Maintainer: CC Web Team (webmaster@concord.org)
Document Options: Text-only / Accessible Version | Printable Version | E-mail this Page

Copyright © 2009, The Concord Consortium.
All rights reserved.

NSF Logo
These materials are based upon work supported
by the National Science Foundation under grant numbers
9980620, ESI-0242701 and EIA-0219345

Any opinions, findings, and conclusions or recommendations expressed in this
material are those of the author(s) and do not necessarily reflect
the views of the National Science Foundation.