DNA to Protein Synthesis

Interactive, scaffolded model

Overview and Learning Objectives

In this activity, students work with a model that shows the entire process from gene transcription and translation, through protein folding of the newly synthesized protein.

Students will be able to:

• reason how DNA, a linear polymer made of four different types of monomers (adenine, thymine, guanine, and cytosine), can store the genetic code: information about sequence of amino acids in proteins;
• describe the processes of translation and transcription;
• compare the structure, location, and function of RNA and DNA;
• manipulate the DNA code and observe how it changes the sequence of m-RNA and proteins.

return to top

Assessment

TEST

http://www.concord.org/~barbara/workbench_web/pdf/DNA_to_Protein8.07.pdf

RUBRIC

http://www.concord.org/~barbara/workbench_web/pdf/DNA_to_Protein_Rubric.8.07a.pdf

return to top

Classroom Practice

Solution For Designer Challenge 4:

TTTTTTTTTGATTTTGATTTTGATTTTGATTTTTTTTTT

Solution for page 5:

GATGATGATTTTTTTTTTTTTTTTTTTTTTCATCATCAT

return to top

Central Concepts

Key Concept:

The sequence of nucleotides in the DNA serves as a genetic code, dictating the sequence of amino acids in proteins.

Additional Related Concepts

Biology

• Genetics

Molecular Biology

• DNA
• RNA

return to top

Textbook References

• Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 10 - Genes and Chromosomes
• Biology (Miller and Levine) Prentice Hall 5th Edition - Unit 2: Chapter 7 - Nucleic Acids and Protein Synthesis
• Biology (Prentice-Hall) New York Edition - Chapter 12: DNA and RNA
• Biology (Prentice-Hall) New York Edition - Chapter 16: Evolution
• Biology (Prentice-Hall) New York Edition - Chapter Seven: Cell Structures and Functions
• Biology: Concepts and Connections (Pearson) 5th Ed. - Chapter 3: The Molecules of Cells
• Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 10: Molecular Biology of the Gene
• Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 12: DNA Technology and the Human Genome
• Biology: Concepts and Connections (Pearson) 5th Edition - Chapter 4: A Tour of the Cell
• Biology: Exploring Life - Chapter 11: DNA and the Language of Life
• Biology: The Dynamics of Life - Chapter 11: DNA and Genes
• BSCS Blue (8th Edition) - Chapter 12: Reproduction
• BSCS Human - Chapter 12: Gene Action
• Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 11: Introduction to Nuclear and chromosomal Structure and Function
• Cell Biology (Pollard and Earnshaw) Saunders 2002 - Chapter 18: Protein Synthesis and Folding in the Cytoplasm
• Web of Life - Chapter 7: DNA, Genes and Chromosomes

return to top

Benchmarks and Standards

AAAS

• THE LIVING ENVIRONMENT: CELLS - The genetic information encoded in DNA molecules provides instructions for assembling protein molecules (Full Text of Standard)
  
  

NSES

• Life Science: Heredity Molecular Basis - 1 In all organisms, the instructions for specifying the characteristics of the organism are carried in DNA (Full Text of Standard)
  
  
• Life Science: The Cell - 3 Cells store and use information to guide their functions (Full Text of Standard)
  
  

return to top

Extensions and Connections

The flash interactive animation included as a link in this activity stands on its own as a learning tool.

http://molo.concord.org/database/activities/273.html

A logical next activity is Mutations

return to top

Additional Info

Additional Background

• DNA Interactive (Howard Hughes and Cold Spring Harbor)

http://www.dnai.org/index.htm

Allows students to follow the footsteps of Crick and Watson as they discover DNA. Flash

• An excellent DNA tutorial done in Chime:

http://www.dnai.org/a/index.html

• Good DNA links

http://molvis.sdsc.edu/dna/moredna.htm

return to top

Activity Credits

Created by CC Project: Molecular Logic using Molecular Workbench

return to top

Requirements

• Java 1.5+ - Java 1.5+ is available for Windows, Linux, and Mac OS X 10.4 and greater. If you are using Mac OS X 10.3, you can download MW Version 1.3 and explore within it instead.

return to top